keyword in microRNA or target gene :
The pre-miRNA of MI0000822
Gene
HGNC MIRN133B
Accession no
MI0000822
ID
hsa-mir-133b
Species
Homo sapiens
Description
Homo sapiens miR-133b stem-loop
Genomic Location
6 : 52121680 - 52121798 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
119 nt
Comments
miR-133b was predicted based on comparative analysis of human, mouse and Fugu [1]. It is homologous to miR-133a (MIR:MI0000450 and MIR:MI0000451), but expression of miR-133b has not been experimentally verified.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-133a-1 dme-mir-133 hsa-mir-133a-1 hsa-mir-133a-2 mmu-mir-133a-2
mmu-mir-133b hsa-mir-133b rno-mir-133a gga-mir-133a-1 gga-mir-133b
gga-mir-133a-2 gga-mir-133c dps-mir-133 xla-mir-133a ame-mir-133
aga-mir-133 dre-mir-133a-2 dre-mir-133a-1 dre-mir-133b dre-mir-133c
ggo-mir-133a age-mir-133a ppa-mir-133a ppy-mir-133a ptr-mir-133a
mml-mir-133a sla-mir-133a lla-mir-133a mne-mir-133a fru-mir-133
tni-mir-133 rno-mir-133b xtr-mir-133c xtr-mir-133d xtr-mir-133b
xtr-mir-133a mdo-mir-133a
The mature miRNA of MI0000822
Mature name
hsa-miR-133b
Mature sequence
67| 5'- UUGGUCCCCUUCAACCAGCUA -3' |87
Target genes
ENST00000376838 (targeted by hsa-miR-133b, predicted by TargetScan)
FKBP12-rapamycin complex-associated protein (FK506-binding protein 12- rapamycin complex-associated protein 1) (Rapamycin target protein) (RAPT1) (Mammalian target of rapamycin) (mTOR). [Source:Uniprot/SWISSPROT;Acc:P42345]
 
     
ENST00000361445 (targeted by hsa-miR-133b, predicted by TargetScan)
FKBP12-rapamycin complex-associated protein (FK506-binding protein 12- rapamycin complex-associated protein 1) (Rapamycin target protein) (RAPT1) (Mammalian target of rapamycin) (mTOR). [Source:Uniprot/SWISSPROT;Acc:P42345]
 
     
ENST00000361947 (targeted by hsa-miR-133b, predicted by TargetScan)
FKBP12-rapamycin complex-associated protein (FK506-binding protein 12- rapamycin complex-associated protein 1) (Rapamycin target protein) (RAPT1) (Mammalian target of rapamycin) (mTOR). [Source:Uniprot/SWISSPROT;Acc:P42345]
 
     
   
 
The reference
Literature
1. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 340787 0937119471