keyword in microRNA or target gene :
The pre-miRNA of MI0000816
Gene
HGNC MIRN335
Accession no
MI0000816
ID
hsa-mir-335
Species
Homo sapiens
Description
Homo sapiens miR-335 stem-loop
Genomic Location
7 : 129923188 - 129923281 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000341441 intron + 2
ENST00000378576 intron + 2
ENST00000223215 intron + 2
OTTHUMT00000138370 intron + 2
OTTHUMT00000138369 intron + 2
OTTHUMT00000059860 intron + 2
View the flanking features in the Genome Browser
Pre-miRNA length
94 nt
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
rno-mir-335 hsa-mir-335 mmu-mir-335
The mature miRNA of MI0000816
Mature name
hsa-miR-335
Mature sequence
16| 5'- UCAAGAGCAAUAACGAAAAAUGU -3' |38
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000377565 (targeted by hsa-miR-335, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-335, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000375226 (targeted by hsa-miR-335, predicted by TargetScan)
retinoblastoma-associated factor 600 [Source:RefSeq_peptide;Acc:NP_065816]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 724822 0937119471