keyword in microRNA or target gene :
The pre-miRNA of MI0000815
Gene
HGNC MIRN339
Accession no
MI0000815
ID
hsa-mir-339
Species
Homo sapiens
Description
Homo sapiens miR-339 stem-loop
Genomic Location
7 : 1029095 - 1029188 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000357429 intron + 2
OTTHUMT00000059162 intron + 1
OTTHUMT00000138560 intron + 2
OTTHUMT00000059963 intron + 2
OTTHUMT00000239206 intron + 2
View the flanking features in the Genome Browser
Pre-miRNA length
94 nt
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,3]. Its expression was later verified in human HL-60 leukemia cells [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
rno-mir-339 mmu-mir-339 hsa-mir-339
The mature miRNA of MI0000815
Mature name
hsa-miR-339
Mature sequence
15| 5'- UCCCUGUCCUCCAGGAGCUCA -3' |35
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000375793 (targeted by hsa-miR-339, predicted by TargetScan)
Pleckstrin homology domain containing, family M (With RUN domain) member 2. [Source:Uniprot/SPTREMBL;Acc:Q5VT65]
 
     
ENST00000375799 (targeted by hsa-miR-339, predicted by TargetScan)
Pleckstrin homology domain containing, family M (With RUN domain) member 2. [Source:Uniprot/SPTREMBL;Acc:Q5VT65]
 
     
ENST00000375753 (targeted by hsa-miR-339, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
3. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 52698 0937119471