keyword in microRNA or target gene :
The pre-miRNA of MI0000814
Gene
HGNC MIRN338
Accession no
MI0000814
ID
hsa-mir-338
Species
Homo sapiens
Description
Homo sapiens miR-338 stem-loop
Genomic Location
17 : 76714278 - 76714344 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000374792 intron + 7
ENST00000326724 intron + 6
OTTHUMT00000282337 intron + 6
OTTHUMT00000256055 intron + 7
OTTHUMT00000256056 intron + 6
View the flanking features in the Genome Browser
Pre-miRNA length
67 nt
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
rno-mir-338 mmu-mir-338 hsa-mir-338 dre-mir-338-1 dre-mir-338-2
dre-mir-338-3 dre-mir-338-4 fru-mir-338 tni-mir-338 xtr-mir-338-1
xtr-mir-338-2 mdo-mir-338
The mature miRNA of MI0000814
Mature name
hsa-miR-338
Mature sequence
42| 5'- UCCAGCAUCAGUGAUUUUGUUGA -3' |64
Target genes
ENST00000378317 (targeted by hsa-miR-338, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
ENST00000377725 (targeted by hsa-miR-338, predicted by TargetScan)
Tumor necrosis factor receptor superfamily member 25 precursor (WSL-1 protein) (Apoptosis-mediating receptor DR3) (Apoptosis-mediating receptor TRAMP) (Death domain receptor 3) (WSL protein) (Apoptosis- inducing receptor AIR) (Apo-3) (Lymphocyte-associate [Source:Uniprot/SWISSPROT;Acc:Q93038]
 
     
ENST00000377728 (targeted by hsa-miR-338, predicted by TargetScan)
Tumor necrosis factor receptor superfamily member 25 precursor (WSL-1 protein) (Apoptosis-mediating receptor DR3) (Apoptosis-mediating receptor TRAMP) (Death domain receptor 3) (WSL protein) (Apoptosis- inducing receptor AIR) (Apo-3) (Lymphocyte-associate [Source:Uniprot/SWISSPROT;Acc:Q93038]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 523259 0937119471