keyword in microRNA or target gene :
The pre-miRNA of MI0000813
Gene
HGNC MIRN324
Accession no
MI0000813
ID
hsa-mir-324
Species
Homo sapiens
Description
Homo sapiens miR-324 stem-loop
Genomic Location
17 : 7067340 - 7067422 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000356839 intron - 11
ENST00000322910 intron - 11
ENST00000350303 intron - 10
OTTHUMT00000285052 intron - 1
OTTHUMT00000285040 intron - 11
OTTHUMT00000285041 intron - 10
OTTHUMT00000285050 intron - 1
OTTHUMT00000285057 intron - 9
OTTHUMT00000285048 intron - 1
OTTHUMT00000285043 intron - 1
OTTHUMT00000285042 intron - 1
OTTHUMT00000285056 intron - 1
View the flanking features in the Genome Browser
Pre-miRNA length
83 nt
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Expression of the miRNA from the 3' arm of the hairpin was later verified in human BC-1 cells [3].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
rno-mir-324 mmu-mir-324 hsa-mir-324
The mature miRNA of MI0000813
Mature name
hsa-miR-324-5p
Mature sequence
16| 5'- CGCAUCCCCUAGGGCAUUGGUGU -3' |38
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000376672 (targeted by hsa-miR-324-5p, predicted by TargetScan)
Mitotic spindle assembly checkpoint protein MAD2B (MAD2-like 2) (hREV7). [Source:Uniprot/SWISSPROT;Acc:Q9UI95]
 
     
ENST00000375226 (targeted by hsa-miR-324-5p, predicted by TargetScan)
retinoblastoma-associated factor 600 [Source:RefSeq_peptide;Acc:NP_065816]
 
     
ENST00000374676 (targeted by hsa-miR-324-5p, predicted by TargetScan)
Basement membrane-specific heparan sulfate proteoglycan core protein precursor (HSPG) (Perlecan) (PLC). [Source:Uniprot/SWISSPROT;Acc:P98160]
 
     
   
 
The mature miRNA of MI0000813
Mature name
hsa-miR-324-3p
Mature sequence
51| 5'- CCACUGCCCCAGGUGCUGCUGG -3' |72
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378322 (targeted by hsa-miR-324-3p, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
ENST00000378317 (targeted by hsa-miR-324-3p, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
ENST00000378320 (targeted by hsa-miR-324-3p, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
3. "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
  Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR
  Proc Natl Acad Sci U S A. 102:5570-5575(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 758182 0937119471