keyword in microRNA or target gene :
The pre-miRNA of MI0000812
Gene
HGNC MIRN331
Accession no
MI0000812
ID
hsa-mir-331
Species
Homo sapiens
Description
Homo sapiens miR-331 stem-loop
Genomic Location
12 : 94226327 - 94226420 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
94 nt
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
rno-mir-331 mmu-mir-331 hsa-mir-331 bta-mir-331
The mature miRNA of MI0000812
Mature name
hsa-miR-331
Mature sequence
61| 5'- GCCCCUGGGCCUAUCCUAGAA -3' |81
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000308647 (targeted by hsa-miR-331, predicted by TargetScan)
ATPase family AAA domain-containing protein 3B. [Source:Uniprot/SWISSPROT;Acc:Q5T9A4]
 
     
ENST00000353409 (targeted by hsa-miR-331, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-331, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 863397 0937119471