keyword in microRNA or target gene :
The pre-miRNA of MI0000811
Gene
HGNC MIRN148B
Accession no
MI0000811
ID
hsa-mir-148b
Species
Homo sapiens
Description
Homo sapiens miR-148b stem-loop
Genomic Location
12 : 53017267 - 53017365 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000262061 intron + 1
OTTHUMT00000261232 intron + 1
OTTHUMT00000261231 intron + 1
OTTHUMT00000261235 intron + 1
OTTHUMT00000261233 intron + 1
OTTHUMT00000261234 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
99 nt
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-152 hsa-mir-148a hsa-mir-152 mmu-mir-148a rno-mir-148b
mmu-mir-148b hsa-mir-148b rno-mir-152 gga-mir-148a dre-mir-148
dre-mir-152 ssc-mir-148a fru-mir-148 tni-mir-148 fru-mir-152
tni-mir-152 bta-mir-148a xtr-mir-148b xtr-mir-148a bta-mir-148b
mdo-mir-152
The mature miRNA of MI0000811
Mature name
hsa-miR-148b
Mature sequence
63| 5'- UCAGUGCAUCACAGAACUUUGU -3' |84
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-148b, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-148b, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000375753 (targeted by hsa-miR-148b, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 423898 0937119471