keyword in microRNA or target gene :
The pre-miRNA of MI0000810
Gene
HGNC MIRN135B
Accession no
MI0000810
ID
hsa-mir-135b
Species
Homo sapiens
Description
Homo sapiens miR-135b stem-loop
Genomic Location
1 : 203684053 - 203684149 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000367154 intron + 1
ENST00000367149 intron + 1
OTTHUMT00000090405 intron + 1
OTTHUMT00000090402 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
97 nt
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-135a-1 hsa-mir-135a-1 hsa-mir-135a-2 rno-mir-135b mmu-mir-135b
mmu-mir-135a-2 hsa-mir-135b rno-mir-135a gga-mir-135a-2 gga-mir-135a-1
gga-mir-135a-3 dre-mir-135c-1 dre-mir-135c-2 dre-mir-135c-3 ssc-mir-135-1
ssc-mir-135-2 lla-mir-135-1 age-mir-135-1 ppa-mir-135-1 mml-mir-135
ptr-mir-135 ggo-mir-135 ppy-mir-135 lla-mir-135-2 age-mir-135-2
ppa-mir-135-2 fru-mir-135b tni-mir-135b dre-mir-135b fru-mir-135a
tni-mir-135a dre-mir-135a xtr-mir-135-1 xtr-mir-135-2 mdo-mir-135a
mdo-mir-135b
The mature miRNA of MI0000810
Mature name
hsa-miR-135b
Mature sequence
16| 5'- UAUGGCUUUUCAUUCCUAUGUG -3' |37
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378609 (targeted by hsa-miR-135b, predicted by TargetScan)
Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 1 (Transducin beta chain 1). [Source:Uniprot/SWISSPROT;Acc:P62873]
 
     
ENST00000378606 (targeted by hsa-miR-135b, predicted by TargetScan)
Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 1 (Transducin beta chain 1). [Source:Uniprot/SWISSPROT;Acc:P62873]
 
     
ENST00000377565 (targeted by hsa-miR-135b, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 916750 0937119471