keyword in microRNA or target gene :
The pre-miRNA of MI0000809
Gene
HGNC MIRN151
Accession no
MI0000809
ID
hsa-mir-151
Species
Homo sapiens
Description
Homo sapiens miR-151 stem-loop
Genomic Location
8 : 141811845 - 141811934 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000354438 intron + 25
ENST00000340930 intron + 22
OTTHUMT00000275586 intron + 20
OTTHUMT00000275592 intron + 22
OTTHUMT00000275597 intron + 17
OTTHUMT00000275595 intron + 22
OTTHUMT00000275589 intron + 8
OTTHUMT00000144449 intron + 20
View the flanking features in the Genome Browser
Pre-miRNA length
90 nt
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-28 mmu-mir-151 rno-mir-151 mmu-mir-28 hsa-mir-151
rno-mir-28 ssc-mir-28 age-mir-28 mml-mir-28 ptr-mir-28
ggo-mir-28 ppy-mir-28 mne-mir-28 sla-mir-28 lla-mir-28
ppa-mir-28 bta-mir-151
The mature miRNA of MI0000809
Mature name
hsa-miR-151
Mature sequence
46| 5'- ACUAGACUGAAGCUCCUUGAGG -3' |67
Target genes
ENST00000373747 (targeted by hsa-miR-151, predicted by TargetScan)
Pumilio homolog 1 (Pumilio-1) (HsPUM). [Source:Uniprot/SWISSPROT;Acc:Q14671]
 
     
ENST00000373749 (targeted by hsa-miR-151, predicted by TargetScan)
Pumilio homolog 1 (Pumilio-1) (HsPUM). [Source:Uniprot/SWISSPROT;Acc:Q14671]
 
     
ENST00000257075 (targeted by hsa-miR-151, predicted by TargetScan)
Pumilio homolog 1 (Pumilio-1) (HsPUM). [Source:Uniprot/SWISSPROT;Acc:Q14671]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
3. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 521911 0937119471