keyword in microRNA or target gene :
The pre-miRNA of MI0000808
Gene
HGNC MIRN326
Accession no
MI0000808
ID
hsa-mir-326
Species
Homo sapiens
Description
Homo sapiens miR-326 stem-loop
Genomic Location
11 : 74723784 - 74723878 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000318275 intron + 1
ENST00000360025 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
95 nt
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-326 rno-mir-326 hsa-mir-326 ssc-mir-326
The mature miRNA of MI0000808
Mature name
hsa-miR-326
Mature sequence
60| 5'- CCUCUGGGCCCUUCCUCCAG -3' |79
Target genes
ENST00000354437 (targeted by hsa-miR-326, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
ENST00000378280 (targeted by hsa-miR-326, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
ENST00000378285 (targeted by hsa-miR-326, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 828239 0937119471