keyword in microRNA or target gene :
The pre-miRNA of MI0000804
Gene
HGNC MIRN328
Accession no
MI0000804
ID
hsa-mir-328
Species
Homo sapiens
Description
Homo sapiens miR-328 stem-loop
Genomic Location
16 : 65793725 - 65793799 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000360833 intron - 12
OTTHUMT00000154879 intron - 12
OTTHUMT00000154878 intron - 12
OTTHUMT00000257667 intron - 12
OTTHUMT00000257669 intron - 13
OTTHUMT00000257668 intron - 12
View the flanking features in the Genome Browser
Pre-miRNA length
75 nt
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
rno-mir-328 mmu-mir-328 hsa-mir-328
The mature miRNA of MI0000804
Mature name
hsa-miR-328
Mature sequence
48| 5'- CUGGCCCUCUCUGCCCUUCCGU -3' |69
Target genes
ENST00000354437 (targeted by hsa-miR-328, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
ENST00000378280 (targeted by hsa-miR-328, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
ENST00000378285 (targeted by hsa-miR-328, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 790857 0937119471