keyword in microRNA or target gene :
The pre-miRNA of MI0000803
Gene
HGNC MIRN330
Accession no
MI0000803
ID
hsa-mir-330
Species
Homo sapiens
Description
Homo sapiens miR-330 stem-loop
Genomic Location
19 : 50834092 - 50834185 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000245925 intron + 1
OTTHUMT00000150830 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
94 nt
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
rno-mir-330 mmu-mir-330 hsa-mir-330
The mature miRNA of MI0000803
Mature name
hsa-miR-330
Mature sequence
57| 5'- GCAAAGCACACGGCCUGCAGAGA -3' |79
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000360054 (targeted by hsa-miR-330, predicted by TargetScan)
Cyclin-L2 (Paneth cell-enhanced expression protein). [Source:Uniprot/SWISSPROT;Acc:Q96S94]
 
     
ENST00000353409 (targeted by hsa-miR-330, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-330, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 955211 0937119471