keyword in microRNA or target gene :
The pre-miRNA of MI0000802
Gene
HGNC MIRN340
Accession no
MI0000802
ID
hsa-mir-340
Species
Homo sapiens
Description
Homo sapiens miR-340 stem-loop
Genomic Location
5 : 179374909 - 179375003 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
95 nt
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
rno-mir-340 mmu-mir-340 hsa-mir-340
The mature miRNA of MI0000802
Mature name
hsa-miR-340
Mature sequence
58| 5'- UCCGUCUCAGUUACUUUAUAGCC -3' |80
Target genes
ENST00000270724 (targeted by hsa-miR-340, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000270724 (targeted by hsa-miR-340, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378964 (targeted by hsa-miR-340, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
   
 
The reference
Literature
1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
  Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G
  Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 279558 0937119471