keyword in microRNA or target gene :
The pre-miRNA of MI0000790
Gene
HGNC MIRN382
Accession no
MI0000790
ID
hsa-mir-382
Species
Homo sapiens
Description
Homo sapiens miR-382 stem-loop
Genomic Location
14 : 100590396 - 100590471 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
76 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-154 mmu-mir-300 hsa-mir-154 rno-mir-323 mmu-mir-323
hsa-mir-369 hsa-mir-377 hsa-mir-381 hsa-mir-382 mmu-mir-377
mmu-mir-381 mmu-mir-382 hsa-mir-323 rno-mir-154 rno-mir-300
mmu-mir-409 mmu-mir-410 hsa-mir-453 hsa-mir-409 ssc-mir-323
hsa-mir-410 hsa-mir-487a ptr-mir-154 ggo-mir-154 ppy-mir-154
mne-mir-154 ppa-mir-154 hsa-mir-494 hsa-mir-496 rno-mir-377
hsa-mir-539 mmu-mir-539 rno-mir-539 hsa-mir-487b mmu-mir-494
mmu-mir-487b mmu-mir-369 rno-mir-494 rno-mir-381 rno-mir-487b
rno-mir-382 rno-mir-409 rno-mir-369 hsa-mir-655 hsa-mir-656
mmu-mir-496 bta-mir-369 bta-mir-487a bta-mir-487b
The mature miRNA of MI0000790
Mature name
hsa-miR-382
Mature sequence
11| 5'- GAAGUUGUUCGUGGUGGAUUCG -3' |32
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000377998 (targeted by hsa-miR-382, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000377565 (targeted by hsa-miR-382, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-382, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Clustering and conservation patterns of human microRNAs"
  Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H
  Nucleic Acids Res. 33:2697-2706(2005).
2. "Identification of clustered microRNAs using an ab initio prediction method"
  Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
  BMC Bioinformatics. 6:267(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 988776 0937119471