keyword in microRNA or target gene :
The pre-miRNA of MI0000789
Gene
HGNC MIRN381
EMBL AY785922
Accession no
MI0000789
ID
hsa-mir-381
Species
Homo sapiens
Description
Homo sapiens miR-381 stem-loop
Genomic Location
14 : 100582010 - 100582084 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
OTTHUMT00000072596 intron + 1
OTTHUMT00000072595 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
75 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-154 mmu-mir-300 hsa-mir-154 rno-mir-323 mmu-mir-323
hsa-mir-369 hsa-mir-377 hsa-mir-381 hsa-mir-382 mmu-mir-377
mmu-mir-381 mmu-mir-382 hsa-mir-323 rno-mir-154 rno-mir-300
mmu-mir-409 mmu-mir-410 hsa-mir-453 hsa-mir-409 ssc-mir-323
hsa-mir-410 hsa-mir-487a ptr-mir-154 ggo-mir-154 ppy-mir-154
mne-mir-154 ppa-mir-154 hsa-mir-494 hsa-mir-496 rno-mir-377
hsa-mir-539 mmu-mir-539 rno-mir-539 hsa-mir-487b mmu-mir-494
mmu-mir-487b mmu-mir-369 rno-mir-494 rno-mir-381 rno-mir-487b
rno-mir-382 rno-mir-409 rno-mir-369 hsa-mir-655 hsa-mir-656
mmu-mir-496 bta-mir-369 bta-mir-487a bta-mir-487b
The mature miRNA of MI0000789
Mature name
hsa-miR-381
Mature sequence
49| 5'- UAUACAAGGGCAAGCUCUCUGU -3' |70
Target genes
ENST00000355249 (targeted by hsa-miR-381, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000353409 (targeted by hsa-miR-381, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-381, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The reference
Literature
1. "Identification of clustered microRNAs using an ab initio prediction method"
  Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
  BMC Bioinformatics. 6:267(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 501513 0937119471