keyword in microRNA or target gene :
The pre-miRNA of MI0000786
Gene
HGNC MIRN378
Accession no
MI0000786
ID
hsa-mir-378
Species
Homo sapiens
Description
Homo sapiens miR-378/miR-422b stem-loop
Genomic Location
5 : 149092581 - 149092646 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000309241 intron + 1
ENST00000360453 intron + 1
OTTHUMT00000252334 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
66 nt
Comments
miR-422b was the most abundant miRNA cloned from human promyelocytic leukemia (HL-60) cells [2]. The sequence appears to originate from the opposite arm of the human homologue of mouse mir-378 [1].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-378 mmu-mir-378 rno-mir-378
The mature miRNA of MI0000786
Mature name
hsa-miR-378
Mature sequence
5| 5'- CUCCUGACUCCAGGUCCUGUGU -3' |26
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378466 (targeted by hsa-miR-378, predicted by TargetScan)
Pantothenate kinase 4 (EC 2.7.1.33) (Pantothenic acid kinase 4) (hPanK4). [Source:Uniprot/SWISSPROT;Acc:Q9NVE7]
 
     
ENST00000353409 (targeted by hsa-miR-378, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-378, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The mature miRNA of MI0000786
Mature name
hsa-miR-422b
Mature sequence
44| 5'- CUGGACUUGGAGUCAGAAGGCC -3' |65
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-422b, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-422b, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000373388 (targeted by hsa-miR-422b, predicted by TargetScan)
CUB and sushi domain-containing protein 2 (CUB and sushi multiple domains protein 2). [Source:Uniprot/SWISSPROT;Acc:Q7Z408]
 
     
   
 
The reference
Literature
1. "A pancreatic islet-specific microRNA regulates insulin secretion"
  Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M
  Nature. 432:226-230(2004).
2. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 101239 0937119471