keyword in microRNA or target gene :
The pre-miRNA of MI0000783
Gene
HGNC MIRN375
Accession no
MI0000783
ID
hsa-mir-375
Species
Homo sapiens
Description
Homo sapiens miR-375 stem-loop
Genomic Location
2 : 219574611 - 219574674 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
64 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-375 mmu-mir-375 dre-mir-375-1 dre-mir-375-2 fru-mir-375
tni-mir-375 gga-mir-375 mdo-mir-375
The mature miRNA of MI0000783
Mature name
hsa-miR-375
Mature sequence
40| 5'- UUUGUUCGUUCGGCUCGCGUGA -3' |61
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000375793 (targeted by hsa-miR-375, predicted by TargetScan)
Pleckstrin homology domain containing, family M (With RUN domain) member 2. [Source:Uniprot/SPTREMBL;Acc:Q5VT65]
 
     
ENST00000375799 (targeted by hsa-miR-375, predicted by TargetScan)
Pleckstrin homology domain containing, family M (With RUN domain) member 2. [Source:Uniprot/SPTREMBL;Acc:Q5VT65]
 
     
ENST00000373210 (targeted by hsa-miR-375, predicted by TargetScan)
Eukaryotic translation initiation factor 2C 4 (eIF2C 4) (eIF-2C 4) (Argonaute-4). [Source:Uniprot/SWISSPROT;Acc:Q9HCK5]
 
     
   
 
The reference
Literature
1. "A pancreatic islet-specific microRNA regulates insulin secretion"
  Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M
  Nature. 432:226-230(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 223611 0937119471