keyword in microRNA or target gene :
The pre-miRNA of MI0000781
Gene
HGNC MIRN373
Accession no
MI0000781
ID
hsa-mir-373
Species
Homo sapiens
Description
Homo sapiens miR-373 stem-loop
Genomic Location
19 : 58983771 - 58983839 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
69 nt
Comments
Human miR-371 (MIR:MI0000779), miR-372 (MIR:MI0000780) and miR-373 (MIR:MI0000781) are clustered within 1.1kb on chromosome 19.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
The mature miRNA of MI0000781
Mature name
hsa-miR-373*
Mature sequence
6| 5'- ACUCAAAAUGGGGGCGCUUUCC -3' |27
Target genes
ENST00000360054 (targeted by hsa-miR-373*, predicted by TargetScan)
Cyclin-L2 (Paneth cell-enhanced expression protein). [Source:Uniprot/SWISSPROT;Acc:Q96S94]
 
     
ENST00000375010 (targeted by hsa-miR-373*, predicted by TargetScan)
HP1-BP74 [Source:RefSeq_peptide;Acc:NP_057371]
 
     
ENST00000375010 (targeted by hsa-miR-373*, predicted by TargetScan)
HP1-BP74 [Source:RefSeq_peptide;Acc:NP_057371]
 
     
   
 
The mature miRNA of MI0000781
Mature name
hsa-miR-373
Mature sequence
44| 5'- GAAGUGCUUCGAUUUUGGGGUGU -3' |66
Target genes
ENST00000377565 (targeted by hsa-miR-373, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-373, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000355249 (targeted by hsa-miR-373, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The reference
Literature
1. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 158070 0937119471