keyword in microRNA or target gene :
The pre-miRNA of MI0000779
Gene
HGNC MIRN371
Accession no
MI0000779
ID
hsa-mir-371
Species
Homo sapiens
Description
Homo sapiens miR-371 stem-loop
Genomic Location
19 : 58982741 - 58982807 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
67 nt
Comments
Human miR-371 (MIR:MI0000779), miR-372 (MIR:MI0000780) and miR-373 (MIR:MI0000781) are clustered within 1.1kb on chromosome 19.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-290 mmu-mir-291a mmu-mir-292 mmu-mir-293 mmu-mir-294
mmu-mir-295 hsa-mir-371 hsa-mir-372 rno-mir-290 rno-mir-291
rno-mir-292 mmu-mir-291b
The mature miRNA of MI0000779
Mature name
hsa-miR-371
Mature sequence
44| 5'- GUGCCGCCAUCUUUUGAGUGU -3' |64
Target genes
ENST00000344008 (targeted by hsa-miR-371, predicted by TargetScan)
Castor homolog 1 zinc finger protein (Castor-related protein) (Zinc finger protein 693). [Source:Uniprot/SWISSPROT;Acc:Q86V15]
 
     
ENST00000377015 (targeted by hsa-miR-371, predicted by TargetScan)
Castor homolog 1 zinc finger protein (Castor-related protein) (Zinc finger protein 693). [Source:Uniprot/SWISSPROT;Acc:Q86V15]
 
     
ENST00000375943 (targeted by hsa-miR-371, predicted by TargetScan)
Caldecrin precursor (EC 3.4.21.2) (Chymotrypsin C). [Source:Uniprot/SWISSPROT;Acc:Q99895]
 
     
   
 
The reference
Literature
1. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 593844 0937119471