keyword in microRNA or target gene :
The pre-miRNA of MI0000778
Gene
HGNC MIRN370
Accession no
MI0000778
ID
hsa-mir-370
Species
Homo sapiens
Description
Homo sapiens miR-370 stem-loop
Genomic Location
14 : 100447229 - 100447303 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
OTTHUMT00000072566 intron + 1
OTTHUMT00000072569 intron + 5
OTTHUMT00000072568 intron + 2
OTTHUMT00000072564 intron + 5
View the flanking features in the Genome Browser
Pre-miRNA length
75 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-370 mmu-mir-370 rno-mir-370
The mature miRNA of MI0000778
Mature name
hsa-miR-370
Mature sequence
48| 5'- GCCUGCUGGGGUGGAACCUGG -3' |68
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378756 (targeted by hsa-miR-370, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
ENST00000378755 (targeted by hsa-miR-370, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
ENST00000339113 (targeted by hsa-miR-370, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
   
 
The reference
Literature
1. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
2. "Identification of clustered microRNAs using an ab initio prediction method"
  Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
  BMC Bioinformatics. 6:267(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 392524 0937119471