keyword in microRNA or target gene :
The pre-miRNA of MI0000775
Gene
HGNC MIRN367
Accession no
MI0000775
ID
hsa-mir-367
Species
Homo sapiens
Description
Homo sapiens miR-367 stem-loop
Genomic Location
4 : 113788479 - 113788546 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000344442 intron - 10
ENST00000308878 intron - 10
ENST00000324052 intron - 11
View the flanking features in the Genome Browser
Pre-miRNA length
68 nt
Comments
Human miR-302a (MIR:MI0000738), miR-302b (MIR:MI0000772), miR-302c (MIR:MI0000773), miR-302d (MIR:MI0000774) and miR-367 (MIR:MI0000775) are clustered on chromosome 4.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-367 mmu-mir-367 gga-mir-367 xtr-mir-367 mdo-mir-367
The mature miRNA of MI0000775
Mature name
hsa-miR-367
Mature sequence
44| 5'- AAUUGCACUUUAGCAAUGGUGA -3' |65
Target genes
ENST00000375010 (targeted by hsa-miR-367, predicted by TargetScan)
HP1-BP74 [Source:RefSeq_peptide;Acc:NP_057371]
 
     
ENST00000375004 (targeted by hsa-miR-367, predicted by TargetScan)
HP1-BP74 [Source:RefSeq_peptide;Acc:NP_057371]
 
     
ENST00000360142 (targeted by hsa-miR-367, predicted by TargetScan)
HP1-BP74 [Source:RefSeq_peptide;Acc:NP_057371]
 
     
   
 
The reference
Literature
1. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
2. "Identification of clustered microRNAs using an ab initio prediction method"
  Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
  BMC Bioinformatics. 6:267(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 273448 0937119471