keyword in microRNA or target gene :
The pre-miRNA of MI0000774
Gene
HGNC MIRN302D
Accession no
MI0000774
ID
hsa-mir-302d
Species
Homo sapiens
Description
Homo sapiens miR-302d stem-loop
Genomic Location
4 : 113788609 - 113788676 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000344442 intron - 10
ENST00000308878 intron - 10
ENST00000324052 intron - 11
View the flanking features in the Genome Browser
Pre-miRNA length
68 nt
Comments
Human miR-302a (MIR:MI0000738), miR-302b (MIR:MI0000772), miR-302c (MIR:MI0000773), miR-302d (MIR:MI0000774) and miR-367 (MIR:MI0000775) are clustered on chromosome 4.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-302 hsa-mir-302a hsa-mir-302b hsa-mir-302c hsa-mir-302d
gga-mir-302a gga-mir-302b gga-mir-302c gga-mir-302d mmu-mir-302b
mmu-mir-302c mmu-mir-302d xtr-mir-302 mdo-mir-302b mdo-mir-302c
mdo-mir-302a mdo-mir-302d
The mature miRNA of MI0000774
Mature name
hsa-miR-302d
Mature sequence
44| 5'- UAAGUGCUUCCAUGUUUGAGUGU -3' |66
Target genes
ENST00000377565 (targeted by hsa-miR-302d, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-302d, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000355249 (targeted by hsa-miR-302d, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The reference
Literature
1. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 980800 0937119471