keyword in microRNA or target gene :
The pre-miRNA of MI0000769
Gene
EMBL AY882279
Accession no
MI0000769
ID
hsa-mir-365-2
Species
Homo sapiens
Description
Homo sapiens miR-365-2 stem-loop
Genomic Location
17 : 26926543 - 26926653 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
111 nt
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MIR:MI0000486).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-365-1 mmu-mir-365-1 hsa-mir-365-2 mmu-mir-365-2 cfa-mir-365-2
rno-mir-365 cfa-mir-365-1 dre-mir-365-1 dre-mir-365-2 dre-mir-365-3
dre-mir-365-4 fru-mir-365 tni-mir-365 gga-mir-365-1 gga-mir-365-2
xtr-mir-365-1 mdo-mir-365 bta-mir-365
The mature miRNA of MI0000769
Mature name
hsa-miR-365
Mature sequence
68| 5'- UAAUGCCCCUAAAAAUCCUUAU -3' |89
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000356315 (targeted by hsa-miR-365, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
ENST00000011700 (targeted by hsa-miR-365, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
ENST00000358136 (targeted by hsa-miR-365, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
   
 
The reference
Literature
1. "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
  Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M
  Nature. 434:338-345(2005).
2. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 997129 0937119471