keyword in microRNA or target gene :
The pre-miRNA of MI0000762
Gene
HGNC MIRN362
EMBL AY882270
Accession no
MI0000762
ID
hsa-mir-362
Species
Homo sapiens
Description
Homo sapiens miR-362 stem-loop
Genomic Location
X : 49660312 - 49660376 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000376108 intron + 3
ENST00000376091 intron + 3
OTTHUMT00000109349 intron + 3
OTTHUMT00000056542 intron + 3
OTTHUMT00000056543 intron + 3
View the flanking features in the Genome Browser
Pre-miRNA length
65 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-362 mmu-mir-362
The mature miRNA of MI0000762
Mature name
hsa-miR-362
Mature sequence
5| 5'- AAUCCUUGGAACCUAGGUGUGAGU -3' |28
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000355249 (targeted by hsa-miR-362, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000356315 (targeted by hsa-miR-362, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
ENST00000011700 (targeted by hsa-miR-362, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
   
 
The reference
Literature
1. "Identification of hundreds of conserved and nonconserved human microRNAs"
  Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z
  Nat Genet. 37:766-770(2005).
2. "Identification of clustered microRNAs using an ab initio prediction method"
  Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
  BMC Bioinformatics. 6:267(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 589370 0937119471