keyword in microRNA or target gene :
The pre-miRNA of MI0000749
Gene
HGNC MIRN30E
Accession no
MI0000749
ID
hsa-mir-30e
Species
Homo sapiens
Description
Homo sapiens miR-30e stem-loop
Genomic Location
1 : 40992614 - 40992705 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000372669 intron + 5
ENST00000355652 intron + 5
ENST00000372658 intron + 5
ENST00000372657 intron + 5
ENST00000372655 intron + 5
ENST00000372654 intron + 6
ENST00000372653 intron + 10
ENST00000372652 intron + 5
ENST00000372651 intron + 5
ENST00000308733 intron + 4
OTTHUMT00000020807 intron + 5
OTTHUMT00000020801 intron + 5
OTTHUMT00000020797 intron + 5
OTTHUMT00000020796 intron + 5
OTTHUMT00000020808 intron + 5
OTTHUMT00000020798 intron + 10
OTTHUMT00000020806 intron + 5
OTTHUMT00000020810 intron + 1
OTTHUMT00000020802 intron + 4
OTTHUMT00000020800 intron + 6
OTTHUMT00000020811 intron + 1
OTTHUMT00000020799 intron + 5
View the flanking features in the Genome Browser
Pre-miRNA length
92 nt
Comments
This sequence is the predicted human homologue of mouse miR-30e [1,2,4]. Mature products from both arms of the precursor (hsa-miR-30e-5p and hsa-miR-30e-3p) were later independently verified in human myelocytic leukemia (HL-60) cells [3]. The sequence maps to chromosome 1.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-30a mmu-mir-30a mmu-mir-30b hsa-mir-30c-2 hsa-mir-30d
mmu-mir-30e hsa-mir-30b mmu-mir-30c-1 mmu-mir-30c-2 mmu-mir-30d
hsa-mir-30c-1 hsa-mir-30e rno-mir-30c-1 rno-mir-30e rno-mir-30b
rno-mir-30d rno-mir-30a rno-mir-30c-2 gga-mir-30d gga-mir-30b
gga-mir-30a gga-mir-30c-2 gga-mir-30e gga-mir-30c-1 dre-mir-30a
dre-mir-30b dre-mir-30c dre-mir-30d dre-mir-30e-2 ssc-mir-30c
mml-mir-30b ptr-mir-30b ggo-mir-30b lla-mir-30b mne-mir-30b
age-mir-30b ppa-mir-30b mml-mir-30a ptr-mir-30a ggo-mir-30a
ppy-mir-30a ppa-mir-30a ptr-mir-30c lla-mir-30c mne-mir-30c
ptr-mir-30d ggo-mir-30d mne-mir-30d ppa-mir-30d fru-mir-30b
tni-mir-30b fru-mir-30d tni-mir-30d fru-mir-30c tni-mir-30c
bta-mir-30d bta-mir-30b xtr-mir-30a xtr-mir-30b xtr-mir-30c-1
xtr-mir-30d xtr-mir-30c-2 xtr-mir-30e bta-mir-30e bta-mir-30a
bta-mir-30c mdo-mir-30a
The mature miRNA of MI0000749
Mature name
hsa-miR-30e-5p
Mature sequence
17| 5'- UGUAAACAUCCUUGACUGGA -3' |36
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000353409 (targeted by hsa-miR-30e-5p, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-30e-5p, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000374630 (targeted by hsa-miR-30e-5p, predicted by TargetScan)
Ephrin type-B receptor 2 precursor (EC 2.7.10.1) (Tyrosine-protein kinase receptor EPH-3) (DRT) (Receptor protein-tyrosine kinase HEK5) (ERK) (Renal carcinoma antigen NY-REN-47). [Source:Uniprot/SWISSPROT;Acc:P29323]
 
     
   
 
The mature miRNA of MI0000749
Mature name
hsa-miR-30e-3p
Mature sequence
59| 5'- CUUUCAGUCGGAUGUUUACAGC -3' |80
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000378514 (targeted by hsa-miR-30e-3p, predicted by TargetScan)
Protein RER1. [Source:Uniprot/SWISSPROT;Acc:O15258]
 
     
ENST00000306256 (targeted by hsa-miR-30e-3p, predicted by TargetScan)
Protein RER1. [Source:Uniprot/SWISSPROT;Acc:O15258]
 
     
ENST00000376572 (targeted by hsa-miR-30e-3p, predicted by TargetScan)
KIAA2013 (KIAA2013), mRNA [Source:RefSeq_dna;Acc:NM_138346]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Embryonic stem cell-specific MicroRNAs"
  Houbaviy HB, Murray MF, Sharp PA
  Dev Cell. 5:351-358(2003).
3. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
4. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 563368 0937119471