keyword in microRNA or target gene :
The pre-miRNA of MI0000748
Gene
HGNC MIRN130B
Accession no
MI0000748
ID
hsa-mir-130b
Species
Homo sapiens
Description
Homo sapiens miR-130b stem-loop
Genomic Location
22 : 20337593 - 20337674 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
82 nt
Comments
This sequence is the predicted human homologue of mouse miR-130b cloned from mouse embryonic stem cells [1,2]. Its expression was later verified in human BC-1 cells [3].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-130a mmu-mir-301 mmu-mir-130b hsa-mir-130a rno-mir-301
hsa-mir-301 hsa-mir-130b rno-mir-130a rno-mir-130b gga-mir-130b
gga-mir-301 gga-mir-130a dre-mir-130a-1 dre-mir-130a-2 dre-mir-130b
dre-mir-130c-1 dre-mir-130c-2 dre-mir-301a-1 dre-mir-301a-2 dre-mir-301b
dre-mir-301c ssc-mir-301 mml-mir-130a ggo-mir-130a mne-mir-130a
ppa-mir-130a fru-mir-301 tni-mir-301 fru-mir-130 tni-mir-130
mmu-mir-301b xtr-mir-130a xtr-mir-130c xtr-mir-130b xtr-mir-301-1
xtr-mir-301-2 mdo-mir-130a
The mature miRNA of MI0000748
Mature name
hsa-miR-130b
Mature sequence
51| 5'- CAGUGCAAUGAUGAAAGGGCAU -3' |72
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-130b, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-130b, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000353409 (targeted by hsa-miR-130b, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The reference
Literature
1. "Embryonic stem cell-specific MicroRNAs"
  Houbaviy HB, Murray MF, Sharp PA
  Dev Cell. 5:351-358(2003).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
3. "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
  Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR
  Proc Natl Acad Sci U S A. 102:5570-5575(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 760669 0937119471