keyword in microRNA or target gene :
The pre-miRNA of MI0000745
Gene
HGNC MIRN301
Accession no
MI0000745
ID
hsa-mir-301
Species
Homo sapiens
Description
Homo sapiens miR-301 stem-loop
Genomic Location
17 : 54583279 - 54583364 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000330137 intron + 1
OTTHUMT00000286171 intron - 1
OTTHUMT00000283588 intron + 1
OTTHUMT00000283589 intron + 1
OTTHUMT00000283593 intron + 1
OTTHUMT00000283590 intron + 1
OTTHUMT00000283591 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
86 nt
Comments
This sequence is the predicted human homologue of mouse miR-301, cloned from mouse embryonic stem cells [1,3]. Its expression has also been confirmed in human ES cells [2]. The sequence maps to chromosome 17.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-130a mmu-mir-301 mmu-mir-130b hsa-mir-130a rno-mir-301
hsa-mir-301 hsa-mir-130b rno-mir-130a rno-mir-130b gga-mir-130b
gga-mir-301 gga-mir-130a dre-mir-130a-1 dre-mir-130a-2 dre-mir-130b
dre-mir-130c-1 dre-mir-130c-2 dre-mir-301a-1 dre-mir-301a-2 dre-mir-301b
dre-mir-301c ssc-mir-301 mml-mir-130a ggo-mir-130a mne-mir-130a
ppa-mir-130a fru-mir-301 tni-mir-301 fru-mir-130 tni-mir-130
mmu-mir-301b xtr-mir-130a xtr-mir-130c xtr-mir-130b xtr-mir-301-1
xtr-mir-301-2 mdo-mir-130a
The mature miRNA of MI0000745
Mature name
hsa-miR-301
Mature sequence
51| 5'- CAGUGCAAUAGUAUUGUCAAAGC -3' |73
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377998 (targeted by hsa-miR-301, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000377565 (targeted by hsa-miR-301, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-301, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Embryonic stem cell-specific MicroRNAs"
  Houbaviy HB, Murray MF, Sharp PA
  Dev Cell. 5:351-358(2003).
2. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
3. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 518376 0937119471