keyword in microRNA or target gene :
The pre-miRNA of MI0000744
Gene
HGNC MIRN299
Accession no
MI0000744
ID
hsa-mir-299
Species
Homo sapiens
Description
Homo sapiens miR-299 stem-loop
Genomic Location
14 : 100559884 - 100559946 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
63 nt
Comments
The sequence from the 5' arm of this miRNA precursor is the predicted human homologue of mouse miR-299, cloned from mouse embryonic stem cells [1,2]. Its expression has not been validated in human. Altuvia et al [3] report the cloning of a miRNA sequence from the 3' arm of the same precursor in human. The sequence maps to chromosome 14.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-299 hsa-mir-299 rno-mir-299
The mature miRNA of MI0000744
Mature name
hsa-miR-299-5p
Mature sequence
7| 5'- UGGUUUACCGUCCCACAUACAU -3' |28
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-299-5p, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-299-5p, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000240185 (targeted by hsa-miR-299-5p, predicted by TargetScan)
TAR DNA-binding protein 43 (TDP-43). [Source:Uniprot/SWISSPROT;Acc:Q13148]
 
     
   
 
The mature miRNA of MI0000744
Mature name
hsa-miR-299-3p
Mature sequence
39| 5'- UAUGUGGGAUGGUAAACCGCUU -3' |60
Target genes
ENST00000377998 (targeted by hsa-miR-299-3p, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000337907 (targeted by hsa-miR-299-3p, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-299-3p, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
   
 
The reference
Literature
1. "Embryonic stem cell-specific MicroRNAs"
  Houbaviy HB, Murray MF, Sharp PA
  Dev Cell. 5:351-358(2003).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
3. "Clustering and conservation patterns of human microRNAs"
  Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H
  Nucleic Acids Res. 33:2697-2706(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 869800 0937119471