keyword in microRNA or target gene :
The pre-miRNA of MI0000742
Gene
HGNC MIRN34B
Accession no
MI0000742
ID
hsa-mir-34b
Species
Homo sapiens
Description
Homo sapiens miR-34b stem-loop
Genomic Location
11 : 110888873 - 110888956 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
84 nt
Comments
Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences. Expression of miR-34b (MIR:MI0000742) and miR-34c (MIR:MI0000743) have not been experimentally verified in human. The mature miR-34b differs at a single position from its mouse homologue.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
cel-mir-34 hsa-mir-34a dme-mir-34 mmu-mir-34c mmu-mir-34b
cbr-mir-34 mmu-mir-34a hsa-mir-34b hsa-mir-34c rno-mir-34b
rno-mir-34c rno-mir-34a gga-mir-34a gga-mir-34b gga-mir-34c
dps-mir-34 dre-mir-34 ggo-mir-34a age-mir-34a ppa-mir-34a
ppy-mir-34a ptr-mir-34a mml-mir-34a sla-mir-34a lla-mir-34a
mne-mir-34a dre-mir-34b bta-mir-34b dre-mir-34c xtr-mir-34a
xtr-mir-34b-2 xtr-mir-34b-4 xtr-mir-34b-3 xtr-mir-34b-1 bmo-mir-34
bta-mir-34c mdo-mir-34a bta-mir-34a ame-mir-34
The mature miRNA of MI0000742
Mature name
hsa-miR-34b
Mature sequence
13| 5'- UAGGCAGUGUCAUUAGCUGAUUG -3' |35
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000338591 (targeted by hsa-miR-34b, predicted by TargetScan)
Kelch-like protein 17 (Actinfilin). [Source:Uniprot/SWISSPROT;Acc:Q6TDP4]
 
     
ENST00000379420 (targeted by hsa-miR-34b, predicted by TargetScan)
Kelch-like protein 17 (Actinfilin). [Source:Uniprot/SWISSPROT;Acc:Q6TDP4]
 
     
ENST00000346387 (targeted by hsa-miR-34b, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
   
 
The reference
Literature
1. "Embryonic stem cell-specific MicroRNAs"
  Houbaviy HB, Murray MF, Sharp PA
  Dev Cell. 5:351-358(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 532540 0937119471