keyword in microRNA or target gene :
The pre-miRNA of MI0000739
Gene
EMBL AF480540
EMBL AF480499
HGNC MIRN101-2
Accession no
MI0000739
ID
hsa-mir-101-2
Species
Homo sapiens
Description
Homo sapiens miR-101-2 stem-loop
Genomic Location
9 : 4840297 - 4840375 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000381750 intron + 8
ENST00000381730 intron + 4
ENST00000381728 intron + 4
OTTHUMT00000051587 intron + 8
OTTHUMT00000051592 intron + 4
OTTHUMT00000051588 intron + 4
OTTHUMT00000051589 intron + 7
View the flanking features in the Genome Browser
Pre-miRNA length
79 nt
Comments
Reference [1] reports two miR-101 precursor hairpin structures in human, on chromosome 1 (MIR:MI0000103) and 9 (MIR:MI0000739, named mir-101-precursor-9 in [1]).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-101-1 mmu-mir-101a rno-mir-101b mmu-mir-101b hsa-mir-101-2
rno-mir-101a gga-mir-101 dre-mir-101a dre-mir-101b ggo-mir-101
sla-mir-101 age-mir-101 ppa-mir-101 ppy-mir-101 ptr-mir-101
mml-mir-101 lla-mir-101 mne-mir-101 fru-mir-101a tni-mir-101a
fru-mir-101b tni-mir-101b bta-mir-101 xtr-mir-101a-2 xtr-mir-101a-1
mdo-mir-101-2 mdo-mir-101-1
The mature miRNA of MI0000739
Mature name
hsa-miR-101
Mature sequence
49| 5'- UACAGUACUGUGAUAACUGAAG -3' |70
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377565 (targeted by hsa-miR-101, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-101, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000374673 (targeted by hsa-miR-101, predicted by TargetScan)
Basement membrane-specific heparan sulfate proteoglycan core protein precursor (HSPG) (Perlecan) (PLC). [Source:Uniprot/SWISSPROT;Acc:P98160]
 
     
   
 
The reference
Literature
1. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
2. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 408361 0937119471