keyword in microRNA or target gene :
The pre-miRNA of MI0000738
Gene
HGNC MIRN302A
Accession no
MI0000738
ID
hsa-mir-302a
Species
Homo sapiens
Description
Homo sapiens miR-302a stem-loop
Genomic Location
4 : 113788788 - 113788856 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000344442 intron - 10
ENST00000308878 intron - 10
ENST00000324052 intron - 11
View the flanking features in the Genome Browser
Pre-miRNA length
69 nt
Comments
miR-302 was first cloned from mouse embryonic stem cells (MIR:MI0000402) [1]. Human miR-302 was predicted based on homology with mouse [3], and later confirmed by cloning in human embryonic stem cells. miR-302a is located in a cluster with the related miRNAs miR-302b (MIR:MI0000772), miR-302c (MIR:MI0000773), miR-302d (MI0000774), and miR-367 (MIR:MI0000775) on human chromosome 4.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-302 hsa-mir-302a hsa-mir-302b hsa-mir-302c hsa-mir-302d
gga-mir-302a gga-mir-302b gga-mir-302c gga-mir-302d mmu-mir-302b
mmu-mir-302c mmu-mir-302d xtr-mir-302 mdo-mir-302b mdo-mir-302c
mdo-mir-302a mdo-mir-302d
The mature miRNA of MI0000738
Mature name
hsa-miR-302a*
Mature sequence
9| 5'- UAAACGUGGAUGUACUUGCUUU -3' |30
Target genes
ENST00000374449 (targeted by hsa-miR-302a*, predicted by TargetScan)
FUS-interacting serine-arginine-rich protein 1 (TLS-associated protein with Ser-Arg repeats) (TLS-associated protein with SR repeats) (TASR) (TLS-associated serine-arginine protein) (TLS-associated SR protein) (40 kDa SR-repressor protein) (SRrp40) (Splic [Source:Uniprot/SWISSPROT;Acc:O75494]
 
     
ENST00000338597 (targeted by hsa-miR-302a*, predicted by TargetScan)
FUS-interacting serine-arginine-rich protein 1 (TLS-associated protein with Ser-Arg repeats) (TLS-associated protein with SR repeats) (TASR) (TLS-associated serine-arginine protein) (TLS-associated SR protein) (40 kDa SR-repressor protein) (SRrp40) (Splic [Source:Uniprot/SWISSPROT;Acc:O75494]
 
     
ENST00000343255 (targeted by hsa-miR-302a*, predicted by TargetScan)
FUS-interacting serine-arginine-rich protein 1 (TLS-associated protein with Ser-Arg repeats) (TLS-associated protein with SR repeats) (TASR) (TLS-associated serine-arginine protein) (TLS-associated SR protein) (40 kDa SR-repressor protein) (SRrp40) (Splic [Source:Uniprot/SWISSPROT;Acc:O75494]
 
     
   
 
The mature miRNA of MI0000738
Mature name
hsa-miR-302a
Mature sequence
44| 5'- UAAGUGCUUCCAUGUUUUGGUGA -3' |66
Target genes
ENST00000378675 (targeted by hsa-miR-302a, predicted by TargetScan)
Matrix metalloproteinase-23 precursor (EC 3.4.24.-) (MMP-23) (Matrix metallopeptidase 21) (MMP-21) (Matrix metalloprotease 22) (MMP-22) (Femalysin) (MIFR-1) [Contains: Matrix metalloproteinase-23, soluble form]. [Source:Uniprot/SWISSPROT;Acc:O75900]
 
     
ENST00000377565 (targeted by hsa-miR-302a, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-302a, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Embryonic stem cell-specific MicroRNAs"
  Houbaviy HB, Murray MF, Sharp PA
  Dev Cell. 5:351-358(2003).
2. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
3. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 17659 0937119471