keyword in microRNA or target gene :
The pre-miRNA of MI0000737
Gene
HGNC MIRN200A
Accession no
MI0000737
ID
hsa-mir-200a
Species
Homo sapiens
Description
Homo sapiens miR-200a stem-loop
Genomic Location
1 : 1093106 - 1093195 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
90 nt
Comments
miR-200a was cloned from mouse kidney tissue [1], and expression later confirmed by cloning in human [3]. The sequence maps to chromosome 1.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
dme-mir-8 mmu-mir-141 mmu-mir-200b hsa-mir-200b hsa-mir-141
mmu-mir-200a hsa-mir-200c mmu-mir-200c hsa-mir-200a rno-mir-141
rno-mir-200c rno-mir-200a rno-mir-200b gga-mir-200a gga-mir-200b
dps-mir-8 xla-mir-429 ame-mir-8 aga-mir-8 hsa-mir-429
mmu-mir-429 rno-mir-429 cfa-mir-429 dre-mir-429 dre-mir-141
dre-mir-200a dre-mir-200b dre-mir-200c mml-mir-200c mml-mir-141
ggo-mir-200c ggo-mir-141 ppy-mir-200c ppy-mir-141 ppa-mir-141
fru-mir-429 tni-mir-429 fru-mir-200a tni-mir-200a fru-mir-200b
tni-mir-200b gga-mir-429 xtr-mir-200a xtr-mir-200b xtr-mir-429
bmo-mir-8 bta-mir-200a bta-mir-200c bta-mir-200b mdo-mir-200c
mdo-mir-141 mdo-mir-200b mdo-mir-200a
The mature miRNA of MI0000737
Mature name
hsa-miR-200a*
Mature sequence
16| 5'- CAUCUUACCGGACAGUGCUGGA -3' |37
Target genes
ENST00000374616 (targeted by hsa-miR-200a*, predicted by TargetScan)
Heterogeneous nuclear ribonucleoprotein R (hnRNP R). [Source:Uniprot/SWISSPROT;Acc:O43390]
 
     
ENST00000302271 (targeted by hsa-miR-200a*, predicted by TargetScan)
Heterogeneous nuclear ribonucleoprotein R (hnRNP R). [Source:Uniprot/SWISSPROT;Acc:O43390]
 
     
ENST00000374614 (targeted by hsa-miR-200a*, predicted by TargetScan)
Heterogeneous nuclear ribonucleoprotein R (hnRNP R). [Source:Uniprot/SWISSPROT;Acc:O43390]
 
     
   
 
The mature miRNA of MI0000737
Mature name
hsa-miR-200a
Mature sequence
54| 5'- UAACACUGUCUGGUAACGAUGU -3' |75
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377845 (targeted by hsa-miR-200a, predicted by TargetScan)
Cytosolic acyl coenzyme A thioester hydrolase (EC 3.1.2.2) (Long chain acyl-CoA thioester hydrolase) (CTE-II) (CTE-IIa) (Brain acyl-CoA hydrolase) (Acyl-CoA thioesterase 7). [Source:Uniprot/SWISSPROT;Acc:O00154]
 
     
ENST00000377855 (targeted by hsa-miR-200a, predicted by TargetScan)
Cytosolic acyl coenzyme A thioester hydrolase (EC 3.1.2.2) (Long chain acyl-CoA thioester hydrolase) (CTE-II) (CTE-IIa) (Brain acyl-CoA hydrolase) (Acyl-CoA thioesterase 7). [Source:Uniprot/SWISSPROT;Acc:O00154]
 
     
ENST00000377083 (targeted by hsa-miR-200a, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
   
 
The reference
Literature
1. "New microRNAs from mouse and human"
  Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T
  RNA. 9:175-179(2003).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
3. "Clustering and conservation patterns of human microRNAs"
  Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H
  Nucleic Acids Res. 33:2697-2706(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 643601 0937119471