keyword in microRNA or target gene :
The pre-miRNA of MI0000734
Gene
HGNC MIRN106B
Accession no
MI0000734
ID
hsa-mir-106b
Species
Homo sapiens
Description
Homo sapiens miR-106b stem-loop
Genomic Location
7 : 99529552 - 99529633 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000362082 intron + 13
ENST00000303887 intron + 13
ENST00000343023 intron + 8
OTTHUMT00000137824 intron + 8
OTTHUMT00000137825 intron + 13
OTTHUMT00000059629 intron + 13
View the flanking features in the Genome Browser
Pre-miRNA length
82 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-17 hsa-mir-18a hsa-mir-20a hsa-mir-93 hsa-mir-106a
mmu-mir-106a mmu-mir-106b mmu-mir-18 mmu-mir-20a mmu-mir-93
rno-mir-20a mmu-mir-17 hsa-mir-106b rno-mir-17 rno-mir-18
rno-mir-93 rno-mir-106b gga-mir-20a gga-mir-18a gga-mir-17
gga-mir-18b gga-mir-106 xla-mir-20 xla-mir-18 gga-mir-20b
hsa-mir-18b hsa-mir-20b dre-mir-17a-1 dre-mir-17a-2 dre-mir-20b
dre-mir-18a dre-mir-18b dre-mir-18c dre-mir-20a dre-mir-93
ssc-mir-106a ssc-mir-20 ssc-mir-18 ggo-mir-17 ggo-mir-18
ggo-mir-20 lca-mir-17 lca-mir-18 lca-mir-20 age-mir-17
age-mir-18 age-mir-20 ppa-mir-17 ppa-mir-18 ppa-mir-20
ppy-mir-17 ppy-mir-18 ppy-mir-20 ptr-mir-17 ptr-mir-18
ptr-mir-20 mml-mir-17 mml-mir-18 mml-mir-20 sla-mir-17
sla-mir-18 sla-mir-20 lla-mir-17 lla-mir-18 lla-mir-20
mne-mir-17 mne-mir-18 mne-mir-20 ggo-mir-106b ggo-mir-93
age-mir-106b age-mir-93 ppa-mir-106b ppa-mir-93 ppy-mir-106b
ppy-mir-93 ptr-mir-106b ptr-mir-93 mml-mir-106b mml-mir-93
sla-mir-106b sla-mir-93 lla-mir-106b lla-mir-93 mne-mir-106b
mne-mir-93 ggo-mir-106a age-mir-106a ppa-mir-106a mml-mir-106a
ppy-mir-106a ptr-mir-106a sla-mir-106a mne-mir-106a fru-mir-17-1
tni-mir-17-1 fru-mir-18 tni-mir-18 fru-mir-17-2 tni-mir-17-2
fru-mir-20 tni-mir-20 mmu-mir-20b rno-mir-20b bta-mir-18b
bta-mir-18a bta-mir-20a xtr-mir-17 xtr-mir-106 xtr-mir-18a
xtr-mir-93a xtr-mir-93b xtr-mir-20a xtr-mir-18b xtr-mir-20b
bta-mir-106 bta-mir-20b bta-mir-17 bta-mir-93 mdo-mir-17
mdo-mir-18 mdo-mir-20 mdo-mir-93
The mature miRNA of MI0000734
Mature name
hsa-miR-106b
Mature sequence
12| 5'- UAAAGUGCUGACAGUGCAGAU -3' |32
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377999 (targeted by hsa-miR-106b, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000377565 (targeted by hsa-miR-106b, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000377565 (targeted by hsa-miR-106b, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "Embryonic stem cell-specific MicroRNAs"
  Houbaviy HB, Murray MF, Sharp PA
  Dev Cell. 5:351-358(2003).
2. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
3. "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
  Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR
  Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 52297 0937119471