keyword in microRNA or target gene :
The pre-miRNA of MI0000681
Gene
MIR
HGNC MIRN155
Accession no
MI0000681
ID
hsa-mir-155
Species
Homo sapiens
Description
Homo sapiens miR-155 stem-loop
Genomic Location
21 : 25868163 - 25868227 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
65 nt
Comments
Human mir-155 is predicted based on homology to a cloned miR from mouse (MIR:MI0000177) [1], and later experimentally validated in human HL-60 leukemia cells [2]. Like the mouse miRNA, human mir-155 resides in the non-coding BIC transcript (EMBL:AF402776), located on chromosome 21 [3]. The mature form differs from that in mouse at a single position. Eis et al. confirm that miR-155 is processed from the BIC transcript in human, and demonstrate elevated expression of miR-155 in lymphoma samples [4].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-155 hsa-mir-155 gga-mir-155 dre-mir-155 xtr-mir-155
The mature miRNA of MI0000681
Mature name
hsa-miR-155
Mature sequence
4| 5'- UUAAUGCUAAUCGUGAUAGGGG -3' |25
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377083 (targeted by hsa-miR-155, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000371191 (targeted by hsa-miR-155, predicted by TargetScan)
Nuclear factor 1 A-type (Nuclear factor 1/A) (NF1-A) (NFI-A) (NF-I/A) (CCAAT-box-binding transcription factor) (CTF) (TGGCA-binding protein). [Source:Uniprot/SWISSPROT;Acc:Q12857]
 
     
ENST00000371187 (targeted by hsa-miR-155, predicted by TargetScan)
Nuclear factor 1 A-type (Nuclear factor 1/A) (NF1-A) (NFI-A) (NF-I/A) (CCAAT-box-binding transcription factor) (CTF) (TGGCA-binding protein). [Source:Uniprot/SWISSPROT;Acc:Q12857]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
3. "New human and mouse microRNA genes found by homology search"
  Weber MJ
  FEBS J. 272:59-73(2005).
4. "Accumulation of miR-155 and BIC RNA in human B cell lymphomas"
  Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF, Lund E, Dahlberg JE
  Proc Natl Acad Sci U S A. 102:3627-3632(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 723256 0937119471