keyword in microRNA or target gene :
The pre-miRNA of MI0000651
Gene
EMBL AJ459701
EMBL AJ459702
EMBL AJ459703
RFAM mir-1
HGNC MIRN1-1
Accession no
MI0000651
ID
hsa-mir-1-1
Species
Homo sapiens
Description
Homo sapiens miR-1-1 stem-loop
Genomic Location
20 : 60561958 - 60562028 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000370527 intron + 2
ENST00000370524 intron + 2
ENST00000370523 intron + 1
OTTHUMT00000109263 intron + 1
OTTHUMT00000109262 intron + 2
View the flanking features in the Genome Browser
Pre-miRNA length
71 nt
Comments
Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437, mouse MIR:MI0000652).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
cel-mir-1 dme-mir-1 mmu-mir-1-1 mmu-mir-206 hsa-mir-1-2
hsa-mir-206 cbr-mir-1 hsa-mir-1-1 mmu-mir-1-2 rno-mir-206
gga-mir-1a-2 gga-mir-206 gga-mir-1a-1 gga-mir-1b dps-mir-1
ame-mir-1 aga-mir-1 dre-mir-1-2 dre-mir-1-1 dre-mir-206-1
dre-mir-206-2 ppy-mir-206 mne-mir-206 ppa-mir-1 fru-mir-1
tni-mir-1 rno-mir-1 xtr-mir-1a-2 xtr-mir-1a-1 xtr-mir-206
xtr-mir-1b bmo-mir-1 mdo-mir-1 mdo-mir-206
The mature miRNA of MI0000651
Mature name
hsa-miR-1
Mature sequence
46| 5'- UGGAAUGUAAAGAAGUAUGUA -3' |66
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000270776 (targeted by hsa-miR-1, predicted by TargetScan)
6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44). [Source:Uniprot/SWISSPROT;Acc:P52209]
 
     
ENST00000377062 (targeted by hsa-miR-1, predicted by TargetScan)
6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44). [Source:Uniprot/SWISSPROT;Acc:P52209]
 
     
ENST00000373340 (targeted by hsa-miR-1, predicted by TargetScan)
Zinc finger MYM-type protein 6 (Zinc finger protein 258). [Source:Uniprot/SWISSPROT;Acc:O95789]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 312729 0937119471