keyword in microRNA or target gene :
The pre-miRNA of MI0000490
Gene
HGNC MIRN206
Accession no
MI0000490
ID
hsa-mir-206
Species
Homo sapiens
Description
Homo sapiens miR-206 stem-loop
Genomic Location
6 : 52117106 - 52117191 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
86 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
cel-mir-1 dme-mir-1 mmu-mir-1-1 mmu-mir-206 hsa-mir-1-2
hsa-mir-206 cbr-mir-1 hsa-mir-1-1 mmu-mir-1-2 rno-mir-206
gga-mir-1a-2 gga-mir-206 gga-mir-1a-1 gga-mir-1b dps-mir-1
ame-mir-1 aga-mir-1 dre-mir-1-2 dre-mir-1-1 dre-mir-206-1
dre-mir-206-2 ppy-mir-206 mne-mir-206 ppa-mir-1 fru-mir-1
tni-mir-1 rno-mir-1 xtr-mir-1a-2 xtr-mir-1a-1 xtr-mir-206
xtr-mir-1b bmo-mir-1 mdo-mir-1 mdo-mir-206
The mature miRNA of MI0000490
Mature name
hsa-miR-206
Mature sequence
53| 5'- UGGAAUGUAAGGAAGUGUGUGG -3' |74
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000378317 (targeted by hsa-miR-206, predicted by TargetScan)
WD repeat protein 8. [Source:Uniprot/SWISSPROT;Acc:Q9P2S5]
 
     
ENST00000374937 (targeted by hsa-miR-206, predicted by TargetScan)
Eukaryotic translation initiation factor 4 gamma 3 (eIF-4-gamma 3) (eIF-4G 3) (eIF4G 3) (eIF-4-gamma II) (eIF4GII). [Source:Uniprot/SWISSPROT;Acc:O43432]
 
     
ENST00000373939 (targeted by hsa-miR-206, predicted by TargetScan)
Syntaxin-12. [Source:Uniprot/SWISSPROT;Acc:Q86Y82]
 
     
   
 
The reference
Literature
1. "New microRNAs from mouse and human"
  Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T
  RNA. 9:175-179(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 76610 0937119471