keyword in microRNA or target gene :
The pre-miRNA of MI0000484
Gene
HGNC MIRN188
Accession no
MI0000484
ID
hsa-mir-188
Species
Homo sapiens
Description
Homo sapiens miR-188 stem-loop
Genomic Location
X : 49654849 - 49654934 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000376108 intron + 3
ENST00000376091 intron + 3
OTTHUMT00000109349 intron + 3
OTTHUMT00000056542 intron + 3
OTTHUMT00000056543 intron + 3
View the flanking features in the Genome Browser
Pre-miRNA length
86 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-188 hsa-mir-188 mml-mir-188 ptr-mir-188 ppy-mir-188
mne-mir-188 ppa-mir-188 hsa-mir-532 mmu-mir-532 hsa-mir-660
bta-mir-532 bta-mir-660
The mature miRNA of MI0000484
Mature name
hsa-miR-188
Mature sequence
15| 5'- CAUCCCUUGCAUGGUGGAGGGU -3' |36
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000337907 (targeted by hsa-miR-188, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-188, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377260 (targeted by hsa-miR-188, predicted by TargetScan)
Beta-catenin-interacting protein 1 (Inhibitor of beta-catenin and Tcf- 4). [Source:Uniprot/SWISSPROT;Acc:Q9NSA3]
 
     
   
 
The reference
Literature
1. "New microRNAs from mouse and human"
  Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T
  RNA. 9:175-179(2003).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 601875 0937119471