keyword in microRNA or target gene :
The pre-miRNA of MI0000480
Gene
HGNC MIRN154
Accession no
MI0000480
ID
hsa-mir-154
Species
Homo sapiens
Description
Homo sapiens miR-154 stem-loop
Genomic Location
14 : 100595845 - 100595928 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
84 nt
Comments
miR-154 is predicted based on homology to a verified miRNA from mouse (MIR:MI0000176) [1]. Its expression was verifed later in human cell lines [3]. Suh et al. [2] have cloned a sequence from human ES cells, which appears to originate from the opposite arm of this hairpin precursor, so is named miR-154* here.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-154 mmu-mir-300 hsa-mir-154 rno-mir-323 mmu-mir-323
hsa-mir-369 hsa-mir-377 hsa-mir-381 hsa-mir-382 mmu-mir-377
mmu-mir-381 mmu-mir-382 hsa-mir-323 rno-mir-154 rno-mir-300
mmu-mir-409 mmu-mir-410 hsa-mir-453 hsa-mir-409 ssc-mir-323
hsa-mir-410 hsa-mir-487a ptr-mir-154 ggo-mir-154 ppy-mir-154
mne-mir-154 ppa-mir-154 hsa-mir-494 hsa-mir-496 rno-mir-377
hsa-mir-539 mmu-mir-539 rno-mir-539 hsa-mir-487b mmu-mir-494
mmu-mir-487b mmu-mir-369 rno-mir-494 rno-mir-381 rno-mir-487b
rno-mir-382 rno-mir-409 rno-mir-369 hsa-mir-655 hsa-mir-656
mmu-mir-496 bta-mir-369 bta-mir-487a bta-mir-487b
The mature miRNA of MI0000480
Mature name
hsa-miR-154
Mature sequence
15| 5'- UAGGUUAUCCGUGUUGCCUUCG -3' |36
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377213 (targeted by hsa-miR-154, predicted by TargetScan)
Protein LZIC (Leucine zipper and ICAT homologous domain-containing protein) (Leucine zipper and CTNNBIP1 domain-containing protein). [Source:Uniprot/SWISSPROT;Acc:Q8WZA0]
 
     
ENST00000371191 (targeted by hsa-miR-154, predicted by TargetScan)
Nuclear factor 1 A-type (Nuclear factor 1/A) (NF1-A) (NFI-A) (NF-I/A) (CCAAT-box-binding transcription factor) (CTF) (TGGCA-binding protein). [Source:Uniprot/SWISSPROT;Acc:Q12857]
 
     
ENST00000371187 (targeted by hsa-miR-154, predicted by TargetScan)
Nuclear factor 1 A-type (Nuclear factor 1/A) (NF1-A) (NFI-A) (NF-I/A) (CCAAT-box-binding transcription factor) (CTF) (TGGCA-binding protein). [Source:Uniprot/SWISSPROT;Acc:Q12857]
 
     
   
 
The mature miRNA of MI0000480
Mature name
hsa-miR-154*
Mature sequence
51| 5'- AAUCAUACACGGUUGACCUAUU -3' |72
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000360054 (targeted by hsa-miR-154*, predicted by TargetScan)
Cyclin-L2 (Paneth cell-enhanced expression protein). [Source:Uniprot/SWISSPROT;Acc:Q96S94]
 
     
ENST00000263694 (targeted by hsa-miR-154*, predicted by TargetScan)
WD repeat protein 57 (Prp8-binding protein) (hPRP8BP) (U5 snRNP- specific 40 kDa protein) (38 kDa-splicing factor). [Source:Uniprot/SWISSPROT;Acc:Q96DI7]
 
     
ENST00000372915 (targeted by hsa-miR-154*, predicted by TargetScan)
Microtubule-actin cross-linking factor 1, isoforms 1/2/3/5 (Actin cross-linking family protein 7) (Macrophin-1) (Trabeculin-alpha) (620 kDa actin-binding protein) (ABP620). [Source:Uniprot/SWISSPROT;Acc:Q9UPN3]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
3. "Clustering and conservation patterns of human microRNAs"
  Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H
  Nucleic Acids Res. 33:2697-2706(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 930106 0937119471