keyword in microRNA or target gene :
The pre-miRNA of MI0000478
Gene
HGNC MIRN149
Accession no
MI0000478
ID
hsa-mir-149
Species
Homo sapiens
Description
Homo sapiens miR-149 stem-loop
Genomic Location
2 : 241044091 - 241044179 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
89 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-149 hsa-mir-149
The mature miRNA of MI0000478
Mature name
hsa-miR-149
Mature sequence
15| 5'- UCUGGCUCCGUGUCUUCACUCC -3' |36
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000308647 (targeted by hsa-miR-149, predicted by TargetScan)
ATPase family AAA domain-containing protein 3B. [Source:Uniprot/SWISSPROT;Acc:Q5T9A4]
 
     
ENST00000378756 (targeted by hsa-miR-149, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
ENST00000378756 (targeted by hsa-miR-149, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 308204 0937119471