keyword in microRNA or target gene :
The pre-miRNA of MI0000477
Gene
HGNC MIRN146A
Accession no
MI0000477
ID
hsa-mir-146a
Species
Homo sapiens
Description
Homo sapiens miR-146a stem-loop
Genomic Location
5 : 159844937 - 159845035 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
99 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-146 hsa-mir-146a rno-mir-146 gga-mir-146a dre-mir-146a
dre-mir-146b-1 dre-mir-146b-2 hsa-mir-146b gga-mir-146b mmu-mir-146b
xtr-mir-146
The mature miRNA of MI0000477
Mature name
hsa-miR-146a
Mature sequence
21| 5'- UGAGAACUGAAUUCCAUGGGUU -3' |42
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000375753 (targeted by hsa-miR-146a, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000375753 (targeted by hsa-miR-146a, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000264203 (targeted by hsa-miR-146a, predicted by TargetScan)
F-actin capping protein subunit beta (CapZ beta). [Source:Uniprot/SWISSPROT;Acc:P47756]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
  Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR
  Proc Natl Acad Sci U S A. 102:5570-5575(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 961015 0937119471