keyword in microRNA or target gene :
The pre-miRNA of MI0000472
Gene
HGNC MIRN127
Accession no
MI0000472
ID
hsa-mir-127
Species
Homo sapiens
Description
Homo sapiens miR-127 stem-loop
Genomic Location
14 : 100419069 - 100419165 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
97 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed by cloning in human cells [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-127 hsa-mir-127 rno-mir-127 oar-mir-127 mml-mir-127
ptr-mir-127 ppy-mir-127 sla-mir-127 lla-mir-127 mne-mir-127
age-mir-127 bta-mir-127
The mature miRNA of MI0000472
Mature name
hsa-miR-127
Mature sequence
57| 5'- UCGGAUCCGUCUGAGCUUGGCU -3' |78
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000378567 (targeted by hsa-miR-127, predicted by TargetScan)
Protein kinase C zeta type (EC 2.7.11.13) (nPKC-zeta). [Source:Uniprot/SWISSPROT;Acc:Q05513]
 
     
ENST00000370521 (targeted by hsa-miR-127, predicted by TargetScan)
Serine/threonine-protein kinase N2 (EC 2.7.11.13) (Protein kinase C- like 2) (Protein-kinase C-related kinase 2). [Source:Uniprot/SWISSPROT;Acc:Q16513]
 
     
ENST00000369565 (targeted by hsa-miR-127, predicted by TargetScan)
AP-4 complex subunit beta-1 (Adapter-related protein complex 4 beta 1 subunit) (Beta subunit of AP-4) (AP-4 adapter complex beta subunit). [Source:Uniprot/SWISSPROT;Acc:Q9Y6B7]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Clustering and conservation patterns of human microRNAs"
  Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H
  Nucleic Acids Res. 33:2697-2706(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 111290 0937119471