keyword in microRNA or target gene :
The pre-miRNA of MI0000471
Gene
HGNC MIRN126
Accession no
MI0000471
ID
hsa-mir-126
Species
Homo sapiens
Description
Homo sapiens miR-126 stem-loop
Genomic Location
9 : 138684875 - 138684959 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000371699 intron + 7
ENST00000308874 intron + 7
ENST00000371698 intron + 6
OTTHUMT00000055096 intron + 6
OTTHUMT00000055099 intron + 5
OTTHUMT00000055094 intron + 7
OTTHUMT00000055095 intron + 7
View the flanking features in the Genome Browser
Pre-miRNA length
85 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human. miR-123 identified in the same mouse study was later found to originate from the same precursor as miR-126 and was hence renamed miR-126*. miR-126* also appears to be conserved in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-126 hsa-mir-126 rno-mir-126 gga-mir-126 dre-mir-126
fru-mir-126 tni-mir-126 bta-mir-126 xtr-mir-126
The mature miRNA of MI0000471
Mature name
hsa-miR-126*
Mature sequence
15| 5'- CAUUAUUACUUUUGGUACGCG -3' |35
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000222122 (targeted by hsa-miR-126*, predicted by miRanda)
D site-binding protein (Albumin D box-binding protein) (Albumin D- element-binding protein) (TAXREB302). [Source:Uniprot/SWISSPROT;Acc:Q10586]
 
     
ENST00000230768 (targeted by hsa-miR-126*, predicted by miRanda)
Protein LAP2 (Erbb2-interacting protein) (Erbin) (Densin-180-like protein). [Source:Uniprot/SWISSPROT;Acc:Q96RT1]
 
     
ENST00000238961 (targeted by hsa-miR-126*, predicted by miRanda)
Uncharacterized protein C10orf6. [Source:Uniprot/SWISSPROT;Acc:Q8IX21]
 
     
   
 
The mature miRNA of MI0000471
Mature name
hsa-miR-126
Mature sequence
52| 5'- UCGUACCGUGAGUAAUAAUGC -3' |72
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000375753 (targeted by hsa-miR-126, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000373939 (targeted by hsa-miR-126, predicted by TargetScan)
Syntaxin-12. [Source:Uniprot/SWISSPROT;Acc:Q86Y82]
 
     
ENST00000237596 (targeted by hsa-miR-126, predicted by TargetScan)
Polycystin-2 (Polycystic kidney disease 2 protein homolog) (Autosomal dominant polycystic kidney disease type II protein) (Polycystwin) (R48321). [Source:Uniprot/SWISSPROT;Acc:Q13563]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 244979 0937119471