keyword in microRNA or target gene :
The pre-miRNA of MI0000470
Gene
HGNC MIRN125B2
Accession no
MI0000470
ID
hsa-mir-125b-2
Species
Homo sapiens
Description
Homo sapiens miR-125b-2 stem-loop
Genomic Location
21 : 16884428 - 16884516 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000308787 intron + 7
ENST00000382955 intron + 5
OTTHUMT00000158034 intron + 5
OTTHUMT00000158031 intron + 1
OTTHUMT00000158030 intron + 6
OTTHUMT00000158037 intron + 3
OTTHUMT00000158038 intron + 3
OTTHUMT00000158029 intron + 6
OTTHUMT00000158032 intron + 5
OTTHUMT00000158035 intron + 3
View the flanking features in the Genome Browser
Pre-miRNA length
89 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-125a mmu-mir-125b-2 dme-mir-125 hsa-mir-125b-1 hsa-mir-125a
hsa-mir-125b-2 mmu-mir-125b-1 rno-mir-125a rno-mir-125b-1 rno-mir-125b-2
gga-mir-125b dps-mir-125 ame-mir-125 aga-mir-125 dre-mir-125a-1
dre-mir-125a-2 dre-mir-125b-1 dre-mir-125b-2 dre-mir-125b-3 dre-mir-125c
ssc-mir-125b ggo-mir-125b-1 age-mir-125b-1 ppa-mir-125b ppy-mir-125b-1
ptr-mir-125b-1 mml-mir-125b-1 sla-mir-125b lla-mir-125b-1 mne-mir-125b-1
ggo-mir-125b-2 age-mir-125b-2 lca-mir-125b ppy-mir-125b-2 ptr-mir-125b-2
mml-mir-125b-2 lla-mir-125b-2 mne-mir-125b-2 fru-mir-125b tni-mir-125b
fru-mir-125a tni-mir-125a bta-mir-125a bta-mir-125b-1 xtr-mir-125b-1
xtr-mir-125b-2 xtr-mir-125a mdo-mir-125b-1 mdo-mir-125b-2 bta-mir-125b-2
The mature miRNA of MI0000470
Mature name
hsa-miR-125b
Mature sequence
17| 5'- UCCCUGAGACCCUAACUUGUGA -3' |38
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000375753 (targeted by hsa-miR-125b, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000375753 (targeted by hsa-miR-125b, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
ENST00000375753 (targeted by hsa-miR-125b, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
2. "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
  Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR
  Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3. "Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation"
  Lee YS, Kim HK, Chung S, Kim KS, Dutta A
  J Biol Chem. 280:16635-16641(2005).
4. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 313785 0937119471