keyword in microRNA or target gene :
The pre-miRNA of MI0000469
Gene
HGNC MIRN125A
Accession no
MI0000469
ID
hsa-mir-125a
Species
Homo sapiens
Description
Homo sapiens miR-125a stem-loop
Genomic Location
19 : 56888319 - 56888404 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
86 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-125a mmu-mir-125b-2 dme-mir-125 hsa-mir-125b-1 hsa-mir-125a
hsa-mir-125b-2 mmu-mir-125b-1 rno-mir-125a rno-mir-125b-1 rno-mir-125b-2
gga-mir-125b dps-mir-125 ame-mir-125 aga-mir-125 dre-mir-125a-1
dre-mir-125a-2 dre-mir-125b-1 dre-mir-125b-2 dre-mir-125b-3 dre-mir-125c
ssc-mir-125b ggo-mir-125b-1 age-mir-125b-1 ppa-mir-125b ppy-mir-125b-1
ptr-mir-125b-1 mml-mir-125b-1 sla-mir-125b lla-mir-125b-1 mne-mir-125b-1
ggo-mir-125b-2 age-mir-125b-2 lca-mir-125b ppy-mir-125b-2 ptr-mir-125b-2
mml-mir-125b-2 lla-mir-125b-2 mne-mir-125b-2 fru-mir-125b tni-mir-125b
fru-mir-125a tni-mir-125a bta-mir-125a bta-mir-125b-1 xtr-mir-125b-1
xtr-mir-125b-2 xtr-mir-125a mdo-mir-125b-1 mdo-mir-125b-2 bta-mir-125b-2
The mature miRNA of MI0000469
Mature name
hsa-miR-125a
Mature sequence
15| 5'- UCCCUGAGACCCUUUAACCUGUG -3' |37
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000354437 (targeted by hsa-miR-125a, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
ENST00000378280 (targeted by hsa-miR-125a, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
ENST00000378285 (targeted by hsa-miR-125a, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 487589 0937119471