keyword in microRNA or target gene :
The pre-miRNA of MI0000468
Gene
HGNC MIRN9-3
Accession no
MI0000468
ID
hsa-mir-9-3
Species
Homo sapiens
Description
Homo sapiens miR-9-3 stem-loop
Genomic Location
15 : 87712252 - 87712341 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
90 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
cel-mir-79 dme-mir-9a mmu-mir-9-2 dme-mir-79 dme-mir-9c
dme-mir-9b hsa-mir-9-1 hsa-mir-9-2 hsa-mir-9-3 cbr-mir-79
mmu-mir-9-1 mmu-mir-9-3 rno-mir-9-1 rno-mir-9-3 rno-mir-9-2
gga-mir-9-2 dps-mir-9a dps-mir-9b dps-mir-9c dps-mir-79
ame-mir-9a ame-mir-9b aga-mir-79 aga-mir-9a aga-mir-9b
aga-mir-9c dre-mir-9-1 dre-mir-9-2 dre-mir-9-4 dre-mir-9-3
dre-mir-9-5 dre-mir-9-6 dre-mir-9-7 ssc-mir-9-1 ssc-mir-9-2
ptr-mir-9 ggo-mir-9 lla-mir-9 mne-mir-9 age-mir-9
fru-mir-9-1 tni-mir-9-1 fru-mir-9-2 tni-mir-9-2 fru-mir-9-4
tni-mir-9-4 fru-mir-9-3 tni-mir-9-3 gga-mir-9-1 xtr-mir-9a-1
xtr-mir-9a-2 xtr-mir-9b xtr-mir-9-3 bmo-mir-9 sme-mir-79
mdo-mir-9-2 mdo-mir-9-1 ame-mir-79
The mature miRNA of MI0000468
Mature name
hsa-miR-9
Mature sequence
16| 5'- UCUUUGGUUAUCUAGCUGUAUGA -3' |38
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000374937 (targeted by hsa-miR-9, predicted by TargetScan)
Eukaryotic translation initiation factor 4 gamma 3 (eIF-4-gamma 3) (eIF-4G 3) (eIF4G 3) (eIF-4-gamma II) (eIF4GII). [Source:Uniprot/SWISSPROT;Acc:O43432]
 
     
ENST00000374937 (targeted by hsa-miR-9, predicted by TargetScan)
Eukaryotic translation initiation factor 4 gamma 3 (eIF-4-gamma 3) (eIF-4G 3) (eIF4G 3) (eIF-4-gamma II) (eIF4GII). [Source:Uniprot/SWISSPROT;Acc:O43432]
 
     
ENST00000374840 (targeted by hsa-miR-9, predicted by TargetScan)
Alkaline phosphatase, tissue-nonspecific isozyme precursor (EC 3.1.3.1) (AP-TNAP) (TNSALP) (Alkaline phosphatase liver/bone/kidney isozyme). [Source:Uniprot/SWISSPROT;Acc:P05186]
 
     
   
 
The mature miRNA of MI0000468
Mature name
hsa-miR-9*
Mature sequence
56| 5'- UAAAGCUAGAUAACCGAAAGU -3' |76
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000311772 (targeted by hsa-miR-9*, predicted by TargetScan)
Nuclear inhibitor of protein phosphatase 1 (NIPP-1) (Protein phosphatase 1 regulatory inhibitor subunit 8) [Includes: Activator of RNA decay (EC 3.1.4.-) (ARD-1)]. [Source:Uniprot/SWISSPROT;Acc:Q12972]
 
     
ENST00000289074 (targeted by hsa-miR-9*, predicted by TargetScan)
Eyes absent homolog 3 (EC 3.1.3.48). [Source:Uniprot/SWISSPROT;Acc:Q99504]
 
     
ENST00000373340 (targeted by hsa-miR-9*, predicted by TargetScan)
Zinc finger MYM-type protein 6 (Zinc finger protein 258). [Source:Uniprot/SWISSPROT;Acc:O95789]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 208287 0937119471