keyword in microRNA or target gene :
The pre-miRNA of MI0000465
Gene
HGNC MIRN191
Accession no
MI0000465
ID
hsa-mir-191
Species
Homo sapiens
Description
Homo sapiens miR-191 stem-loop
Genomic Location
3 : 49033055 - 49033146 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000313778 intron + 1
ENST00000326912 intron - 1
OTTHUMT00000264570 intron + 1
OTTHUMT00000264571 intron + 1
OTTHUMT00000264552 intron - 1
View the flanking features in the Genome Browser
Pre-miRNA length
92 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed in human HL-60 leukemia cells [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-191 hsa-mir-191 rno-mir-191 xtr-mir-191 bta-mir-191
mdo-mir-191
The mature miRNA of MI0000465
Mature name
hsa-miR-191
Mature sequence
16| 5'- CAACGGAAUCCCAAAAGCAGCU -3' |37
Tissue specificity

QPCR microRNA expression profile

 

Target genes
ENST00000373428 (targeted by hsa-miR-191, predicted by TargetScan)
Zinc finger protein 362 (Hypothetical protein FLJ25476) (FLJ25476 protein). [Source:Uniprot/SPTREMBL;Acc:Q5T0B9]
 
     
ENST00000373418 (targeted by hsa-miR-191, predicted by TargetScan)
Polyhomeotic-like protein 2 (hPH2) (Early development regulatory protein 2). [Source:Uniprot/SWISSPROT;Acc:Q8IXK0]
 
     
ENST00000307890 (targeted by hsa-miR-191, predicted by TargetScan)
Polyhomeotic-like protein 2 (hPH2) (Early development regulatory protein 2). [Source:Uniprot/SWISSPROT;Acc:Q8IXK0]
 
     
   
 
The mature miRNA of MI0000465
Mature name
hsa-miR-191*
Mature sequence
58| 5'- GCUGCGCUUGGAUUUCGUCCCC -3' |79
Target genes
ENST00000377998 (targeted by hsa-miR-191*, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000377565 (targeted by hsa-miR-191*, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-191*, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The reference
Literature
1. "New microRNAs from mouse and human"
  Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T
  RNA. 9:175-179(2003).
2. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
3. "Clustering and conservation patterns of human microRNAs"
  Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H
  Nucleic Acids Res. 33:2697-2706(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 985965 0937119471