keyword in microRNA or target gene :
The pre-miRNA of MI0000464
Gene
HGNC MIRN153-2
Accession no
MI0000464
ID
hsa-mir-153-2
Species
Homo sapiens
Description
Homo sapiens miR-153-2 stem-loop
Genomic Location
7 : 157059789 - 157059875 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000389419 intron + 19
ENST00000389418 intron + 19
ENST00000331938 intron + 19
ENST00000389416 intron + 18
ENST00000356755 intron + 18
ENST00000389413 intron + 18
ENST00000389414 intron + 18
ENST00000347562 intron + 18
ENST00000328101 intron + 19
OTTHUMT00000137436 intron + 19
OTTHUMT00000137435 intron + 18
OTTHUMT00000137434 intron + 18
View the flanking features in the Genome Browser
Pre-miRNA length
87 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-153 hsa-mir-153-1 hsa-mir-153-2 rno-mir-153 gga-mir-153
dre-mir-153b dre-mir-153a dre-mir-153c ssc-mir-153 mml-mir-153-1
ppy-mir-153 mne-mir-153-1 mml-mir-153-2 ggo-mir-153 mne-mir-153-2
fru-mir-153b tni-mir-153b fru-mir-153a tni-mir-153a xtr-mir-153-1
xtr-mir-153-2
The mature miRNA of MI0000464
Mature name
hsa-miR-153
Mature sequence
53| 5'- UUGCAUAGUCACAAAAGUGA -3' |72
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000321358 (targeted by hsa-miR-153, predicted by TargetScan)
Nuclease sensitive element-binding protein 1 (Y-box-binding protein 1) (Y-box transcription factor) (YB-1) (CCAAT-binding transcription factor I subunit A) (CBF-A) (Enhancer factor I subunit A) (EFI-A) (DNA-binding protein B) (DBPB). [Source:Uniprot/SWISSPROT;Acc:P67809]
 
     
ENST00000372172 (targeted by hsa-miR-153, predicted by TargetScan)
Probable E3 ubiquitin-protein ligase HECTD3 (HECT domain-containing protein 3). [Source:Uniprot/SWISSPROT;Acc:Q5T447]
 
     
ENST00000371236 (targeted by hsa-miR-153, predicted by TargetScan)
Disabled homolog 1. [Source:Uniprot/SWISSPROT;Acc:O75553]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 4789 0937119471