keyword in microRNA or target gene :
The pre-miRNA of MI0000463
Gene
HGNC MIRN153-1
Accession no
MI0000463
ID
hsa-mir-153-1
Species
Homo sapiens
Description
Homo sapiens miR-153-1 stem-loop
Genomic Location
2 : 219867077 - 219867166 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
90 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-153 hsa-mir-153-1 hsa-mir-153-2 rno-mir-153 gga-mir-153
dre-mir-153b dre-mir-153a dre-mir-153c ssc-mir-153 mml-mir-153-1
ppy-mir-153 mne-mir-153-1 mml-mir-153-2 ggo-mir-153 mne-mir-153-2
fru-mir-153b tni-mir-153b fru-mir-153a tni-mir-153a xtr-mir-153-1
xtr-mir-153-2
The mature miRNA of MI0000463
Mature name
hsa-miR-153
Mature sequence
54| 5'- UUGCAUAGUCACAAAAGUGA -3' |73
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000321358 (targeted by hsa-miR-153, predicted by TargetScan)
Nuclease sensitive element-binding protein 1 (Y-box-binding protein 1) (Y-box transcription factor) (YB-1) (CCAAT-binding transcription factor I subunit A) (CBF-A) (Enhancer factor I subunit A) (EFI-A) (DNA-binding protein B) (DBPB). [Source:Uniprot/SWISSPROT;Acc:P67809]
 
     
ENST00000372172 (targeted by hsa-miR-153, predicted by TargetScan)
Probable E3 ubiquitin-protein ligase HECTD3 (HECT domain-containing protein 3). [Source:Uniprot/SWISSPROT;Acc:Q5T447]
 
     
ENST00000371236 (targeted by hsa-miR-153, predicted by TargetScan)
Disabled homolog 1. [Source:Uniprot/SWISSPROT;Acc:O75553]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 637101 0937119471