keyword in microRNA or target gene :
The pre-miRNA of MI0000462
Gene
HGNC MIRN152
Accession no
MI0000462
ID
hsa-mir-152
Species
Homo sapiens
Description
Homo sapiens miR-152 stem-loop
Genomic Location
17 : 43469526 - 43469612 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000006101 intron + 2
OTTHUMT00000283332 intron + 1
OTTHUMT00000283329 intron + 1
OTTHUMT00000283330 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
87 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-152 hsa-mir-148a hsa-mir-152 mmu-mir-148a rno-mir-148b
mmu-mir-148b hsa-mir-148b rno-mir-152 gga-mir-148a dre-mir-148
dre-mir-152 ssc-mir-148a fru-mir-148 tni-mir-148 fru-mir-152
tni-mir-152 bta-mir-148a xtr-mir-148b xtr-mir-148a bta-mir-148b
mdo-mir-152
The mature miRNA of MI0000462
Mature name
hsa-miR-152
Mature sequence
54| 5'- UCAGUGCAUGACAGAACUUGGG -3' |75
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000378567 (targeted by hsa-miR-152, predicted by TargetScan)
Protein kinase C zeta type (EC 2.7.11.13) (nPKC-zeta). [Source:Uniprot/SWISSPROT;Acc:Q05513]
 
     
ENST00000337907 (targeted by hsa-miR-152, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
ENST00000377464 (targeted by hsa-miR-152, predicted by TargetScan)
Arginine-glutamic acid dipeptide repeats protein (Atrophin-1-like protein) (Atrophin-1-related protein). [Source:Uniprot/SWISSPROT;Acc:Q9P2R6]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 521717 0937119471