keyword in microRNA or target gene :
The pre-miRNA of MI0000460
Gene
HGNC MIRN144
Accession no
MI0000460
ID
hsa-mir-144
Species
Homo sapiens
Description
Homo sapiens miR-144 stem-loop
Genomic Location
17 : 24212677 - 24212762 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
86 nt
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
mmu-mir-144 hsa-mir-144 rno-mir-144 dre-mir-144 ptr-mir-144
ppy-mir-144 mne-mir-144 ppa-mir-144 fru-mir-144 tni-mir-144
xtr-mir-144 gga-mir-144 mdo-mir-144
The mature miRNA of MI0000460
Mature name
hsa-miR-144
Mature sequence
52| 5'- UACAGUAUAGAUGAUGUACUAG -3' |73
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000311066 (targeted by hsa-miR-144, predicted by TargetScan)
PR domain zinc finger protein 2 (PR domain-containing protein 2) (Retinoblastoma protein-interacting zinc-finger protein) (Zinc finger protein RIZ) (MTE-binding protein) (MTB-ZF) (GATA-3-binding protein G3B). [Source:Uniprot/SWISSPROT;Acc:Q13029]
 
     
ENST00000343137 (targeted by hsa-miR-144, predicted by TargetScan)
PR domain zinc finger protein 2 (PR domain-containing protein 2) (Retinoblastoma protein-interacting zinc-finger protein) (Zinc finger protein RIZ) (MTE-binding protein) (MTB-ZF) (GATA-3-binding protein G3B). [Source:Uniprot/SWISSPROT;Acc:Q13029]
 
     
ENST00000375753 (targeted by hsa-miR-144, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
   
 
The reference
Literature
1. "Identification of tissue-specific microRNAs from mouse"
  Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T
  Curr Biol. 12:735-739(2002).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 150341 0937119471